site stats

Phee401e vector

WebSep 27, 2024 · The target-specified guide RNA (gRNA) sequences were cloned into a binary vector harbouring the cas9 gene under control of a ubiquitin promoter from parsley (Figure S1; Kawalleck et al ., 1993 ). The binary vectors targeting CsGTR1 and CsGTR2 harboured four gRNAs, while the vector for CsMYB28 and CsMYB29 contained three gRNAs. WebNov 22, 2024 · The pHEE401E_UBQ_Bar vector is a version in which the egg-specific promoter for Cas9 expression in the pHEE401E vector was replaced with the UBQ10 …

pHEE401E - Lifeasible

WebNov 22, 2024 · The vectors used were pHEE401E_UBQ_Bar and pBAtC_tRNA, which employ a one-promoter/one-sgRNA and a polycistronic-tRNA-gRNA strategy, respectively. Golden … WebpHEE401E (Plasmid #71287) Print Enlarge View all sequences Purpose Egg cell-specific promoter-controlled expression of 3×FLAG-NLS-zCas9-NLS. Contains gRNA scaffold for … Plasmid pHEE401 from Dr. Qi-Jun Chen's lab contains the inserts sgRNA scaffold … Plasmid pCBC-DT1T2 from Dr. Qi-Jun Chen's lab contains the insert T1, U626t … philippine international balloon festival https://paramed-dist.com

The Tomato Transcription Factor SlNAC063 Is Required for …

WebpHEE401E vector Sequence Copy Sequence Download GeneBank File(.gb) LOCUS Exported 17112 bp ds-DNA circular SYN 13-MAY-2024 DEFINITION Egg cell-specific promoter-controlled expression of 3×FLAG-NLS-zCas9-NLS. Contains gRNA scaffold for insertion of target ACCESSION . VERSION . WebMar 15, 2024 · Then the fragment was ligated into the binary vector pHEE401E by the restriction-ligation system ( Wang et al., 2015 ). Then, the recombinant plasmid pHEE401E-2sgRNA-SlNAC063 was transformed into wild-type tomato AC using the stable A. tumefaciens -mediated transformation method ( McCormick et al., 1986; Gupta and Van … WebpHEE401E (~100 ng/μl) 2 μl 10× T4 DNA Ligase Buffer (NEB) 1.5 μl 10× BSA 1.5 μl BsaI (NE B) 1 μl T4 DNA Ligase (HC, NEB) 1 μl ddH 2 O 6 μl Total volume 15 μl 5. Transform E.coli … philippine interisland shipping association

Construction of Multiple Guide RNAs in CRISPR/Cas9 Vector Using …

Category:crispr_cas9_arabidopsis/pHEE401E.gbk at master - Github

Tags:Phee401e vector

Phee401e vector

Construction of Multiple Guide RNAs in CRISPR/Cas9 …

WebDec 19, 2024 · To construct pHEE401E ( Wang et al., 2015) vectors targeting four different sites of PAR1 and one site of JAZ1 or GAI, the dsDNA was fused to the Bs a I-digested vector pHEE401E using T4 DNA ligase (EL0011, Thermo Scientific™). WebSep 24, 2024 · The structure of CSE-653 vector designed to sequentially cut S653 codon twice. pHEE401E backbone was used to ubiquitously express two sgRNAs by U6-26 and U6-29 promoters, and Cas9 was driven by an ...

Phee401e vector

Did you know?

WebAug 16, 2024 · Building on the pHEE401E plasmid, a Cambia T-DNA adapted for 96 genome editing with CRISPR/Cas9 nucleases (Wang & al., 2015), we created a series of 97 vectors enabling selection and counter-selection of transgenics on the basis of seed 98 fluorescence. Toward this end, we replaced the hygromycin resistance marker of pHEE401E WebNational Center for Biotechnology Information

WebLxiyu 6 Pack Pool Filter for Type I Filters Pump, Compatible with Bestway 58093 Filter,for Spa Filter Pool Pump Flowclear 58381 58511e 300/330 Gal/H (220-240 V) 4.5 (99) $2199. … WebNov 22, 2024 · The pHEE401E vector has a type IIS restriction-enzyme-recognition site for ligation [6]. The other is a pBAtC-tRNA vector that uses a polycistronic tRNA-gRNA expression system and has two AarI type IIS restriction enzyme sites. Originally, these two vectors could carry two sgRNAs.

WebpHSE401 (Plasmid #62201) Print Enlarge View all sequences Purpose CRISPR/Cas based plant genome editing and gene regulation; expresses 3×FLAG-NLS-zCas9-NLS, gRNA … WebThe pHEE401E vector contains an antibiotic resistance gene, Hygromycin, which allows for this selection. Seeds which are able to grow healthy on the antibiotic plates are chosen to be grown into the next generation. Arabidopsis thaliana Plant Genotyping

WebApr 13, 2024 · To generate mutants of npf8.4-2 and npf8.4-3, two single guide RNAs (AGTTCCGGGTCTTAAGCCAG and GAGATGCAAACACTAACCCG; Genomics Inc.) targeting NPF8.4 were inserted into the binary vector pHEE401E ...

WebSep 20, 2024 · Overexpression of SNIPER1 leads to globally reduced accumulation of sNLRs, but not the downstream helper NLRs ADR1 and NRG1, resulting in compromised … philippine international airports listWebOct 24, 2024 · Two sgRNAs were designed and cloned into pHEE401E as described by Wang et al. (2015b). ... China) for the CRISPR/Cas9 vector; Xiao-Su Gao, Jiqin Li, Yun-Xiao He, and Shui-Ning Yang (Chinese Academy of Sciences Center for Excellence in Molecular Plant Sciences, China) for skillful technical assistance; Hongtao Liu, Lin Xu (Chinese Academy … trumpet that plays tapsWebAug 13, 2024 · EAR (Ethylene-responsive element binding factor-associated Amphiphilic Repression) motif-containing transcription repressors have been shown to regulate plant growth and development, and plant responses to plant hormones and environmental stresses including biotic and abiotic stresses. However, the functions of most EAR-motif … philippine international baptist churchWebJun 22, 2024 · a A schematic representation of the gene drive that is inserted into the second exon of the CRYPTOCHROME 1 ( CRY1) gene on Chromosome IV using CRISPR/Cas9-mediated homology-directed repair (HDR).... philippine international church livephilippine international airportWebJan 17, 2024 · pHEE401E binary vector. pHEE401E is based on pCambia backbone for Agrobacterium-mediated transformation. It contains the complementary parts of the … philippine international development incWebNov 22, 2024 · The pHEE401E vector has a type IIS restriction-enzyme-recognition site for ligation [6]. The other is a pBAtC-tRNA vector that uses a polycistronic tRNA-gRNA … philippine international airport map